View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_18 (Length: 256)
Name: NF10077_low_18
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10077_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 41196951 - 41197043
Alignment:
| Q |
19 |
atgcgatggagtatttccctttagatcatgaaaccagcgcataaagacaccaccaccttaaaattgagaatataatccaaataatatgtactc |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41196951 |
atgcgatggagtatttccttttagatcatgaaaccagcgcataaagacaccaccaccttaaaattgagaatataatccaaataatttgtactc |
41197043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 179 - 243
Target Start/End: Original strand, 41197111 - 41197175
Alignment:
| Q |
179 |
agttctttaattatctagagtaatatcaattatgtttgttgatttttcagattaaaaaatagtct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41197111 |
agttctttaattatctagagtaatatcaattatgtttgttgatttttcagattaaaaaatagtct |
41197175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University