View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_19 (Length: 254)
Name: NF10077_low_19
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10077_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 3689045 - 3689275
Alignment:
Q |
7 |
atatatatatttaattagatcaggtaatcaaaatgataataaggatgatggtatagttcataacttcatatcagatttcataaaaaagaattatcaatgg |
106 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3689045 |
atatatatatttaatttgatcaggtaatcaaaatgataataaggatgatggtatagttcataacttcatatcagatttcataaaaaagaattatcaatgg |
3689144 |
T |
 |
Q |
107 |
ccagatataattaatgtgcctagctttcannnnnnnngtgttcgtcttgttatatacatatcttgatttgaaacaaaaattgaactcacttgatacaagt |
206 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
3689145 |
ccagatataattaatgtgcctagctttcattttttttgtgttcgtcttgttatatacatatcttgatttgaaacaaaaattgaactcactagatacaagt |
3689244 |
T |
 |
Q |
207 |
tgatgaaattatttattttggacatgaatac |
237 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
3689245 |
tgatgaaattatttattttggacatgaatac |
3689275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University