View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_21 (Length: 239)
Name: NF10077_low_21
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10077_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 12 - 224
Target Start/End: Complemental strand, 2656094 - 2655882
Alignment:
| Q |
12 |
catagactagaagagaatatagaaactagaagaggttccatttatctgagtccaaatcagaagaaaatggccacaattcaggaaaggaaaaagatagaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656094 |
catagactagaagagaatatagaaactagaagaggttccatttatctgagtccaaatcagaagaaaatggccacaattcaggaaaggaaaaagatagaaa |
2655995 |
T |
|
| Q |
112 |
tttcaagtaggactagtgacaactcttattcgggtagcattttttatgcattgtgtagtggttcagatgatgaaggttctgttgaggttgagacaccttc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2655994 |
tttcaagtaggactagtgacaactcttattcgggtagcattttttatgcattgtgtagtggttcagatgatgaagattctgttgaggttgagacaccttc |
2655895 |
T |
|
| Q |
212 |
ttcagtaatatct |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2655894 |
ttcagtaatatct |
2655882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University