View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_26 (Length: 220)
Name: NF10077_low_26
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10077_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 10 - 202
Target Start/End: Complemental strand, 18586899 - 18586707
Alignment:
| Q |
10 |
agaagcagagaatgattctgaactaaagaatttgttttcccaaccatgcaacccaactttatatgtccacttgtgtgatgacaaatctttgatgattgtc |
109 |
Q |
| |
|
||||||| |||||| ||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18586899 |
agaagcaaagaatgtatcttgactaaaaaatttgttttcccaaccatgcaacccaactttgtatgtccacttgtgtgatgacaaatctttgatgattgtc |
18586800 |
T |
 |
| Q |
110 |
tcatcaccttttgtaccaatcaattcaataggactaacaagaccatcttgccatttatcatattcttttccataattctattatccacaaaat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18586799 |
tcatcaccttttgtaccaatcaattcaataggactaacaagaccatcttgccatttatcatattcttttccataattctattatccacaaaat |
18586707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University