View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_27 (Length: 213)
Name: NF10077_low_27
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10077_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 51674076 - 51674269
Alignment:
| Q |
1 |
aaccggaagcaaaaccgagagacggagcaatgaaatcgattgaattaacggaagagcattgagagattagcgtatcgaagagattttgaaacggtgacgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
51674076 |
aaccggaagcaaaaccgagagacggagcaatgaaatcgattgaattaacggaagagcattgagagattagcgtgttgaagagattttcaaacggtgacgg |
51674175 |
T |
 |
| Q |
101 |
tggaggaacggggaatgaggctttgattttgagtcggcggcgtttgtagagacggaattggcgggaagggaagggtttggcgggaagaaaagag |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51674176 |
tggaggaacggggaatgaggctttgattttgagtcggcggcgtttgtagagacggaattggcgggaagggaagggtttggcgggaagaaaagag |
51674269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University