View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10077_low_8 (Length: 401)
Name: NF10077_low_8
Description: NF10077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10077_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 17 - 384
Target Start/End: Complemental strand, 40516219 - 40515855
Alignment:
Q |
17 |
cagagatagggtaagacagtaacttagtacggatttgataggtcagctattttatagagaaagggttatatgtggggctggggctgctagaataatcaac |
116 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40516219 |
cagagataggataagacagtaacttagtacggatttgataggtcagctattttatagagaaagggttatatgtggggctggggctgctagaataatcaac |
40516120 |
T |
 |
Q |
117 |
tttttactattcacatataagaaactactaaaaaataacagtgttcaggcttttgttgctgcttatgatacagattaattattattgtttatattattac |
216 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40516119 |
tttttactattcacatataagaaacta---aaaaataacagtgttcaggcttttgttgctgcttatgatacagattaattattattgtttatattattaa |
40516023 |
T |
 |
Q |
217 |
agtgagtacagagagagatgcattttccccttcnnnnnnnctttcccttttggccccattccattgtcttgctatttattaaggtcatttatacatttgg |
316 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40516022 |
agtgagtacagagagagatgcattttccccttctttttttcttttccttttggccccattccattgtcttgctatttattaaggtcatttatacatttgg |
40515923 |
T |
 |
Q |
317 |
ctatattgcaggtgtacgaaatcctaagccactgataaaagccgaggaatgcggaattgctttactac |
384 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40515922 |
ctatattgcaggtgtacgaaatcctaagccactgataaaagccgaggaatgcggaattgctttactac |
40515855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University