View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10078_high_10 (Length: 359)
Name: NF10078_high_10
Description: NF10078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10078_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 351
Target Start/End: Original strand, 48486701 - 48487053
Alignment:
| Q |
1 |
cttagctctataatgtggatccagaatgccattatctgccaacattgcctcctccattgcctcgtgaaagtcacttcctttggtcttgtacaatcgggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486701 |
cttagctctataatgtggatccagaatgccattatctgccaacattgcctcctccattgcctcgtgaaagtcacttcctttggtcttgtacaatcgggtc |
48486800 |
T |
 |
| Q |
101 |
tgcccctggaatctgaacaagattattcttaatatgagcgaatacaagccaaatattcttgcaggcagaacaacaaccaaaat--cacacacaaacacaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48486801 |
tgcccctggaatctgaacaagattattcttaatatgagcgagtacaagccaaatattcttgcaggcagaacaacaaccaaaatcacacacacaaacacaa |
48486900 |
T |
 |
| Q |
199 |
acctatccatgaattccaagaaggggaataccatcccctgcttcgcccatgcatagtcctgccaagtgcccatcacaaattcattagatttcaacaataa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486901 |
acctatccatgaattccaagaaggggaataccatcccctgcttcgcccatgcatagtcctgccaagtgcccatcacaaattcattagatttcaacaataa |
48487000 |
T |
 |
| Q |
299 |
caacaactcaaacctttacataaaggtgtgttgagaagagcttaccctatgct |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48487001 |
caacaactcaaacctttacataaaggtgtgttgagaagagcttaccctgtgct |
48487053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University