View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10078_high_15 (Length: 254)
Name: NF10078_high_15
Description: NF10078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10078_high_15 |
 |  |
|
[»] scaffold1634 (1 HSPs) |
 |  |  |
|
[»] scaffold0064 (1 HSPs) |
 |  |  |
|
[»] scaffold0029 (3 HSPs) |
 |  |  |
|
[»] scaffold1719 (1 HSPs) |
 |  |  |
|
[»] scaffold0755 (1 HSPs) |
 |  |  |
|
[»] scaffold0068 (2 HSPs) |
 |  |  |
|
[»] scaffold0011 (2 HSPs) |
 |  |  |
|
[»] scaffold0431 (1 HSPs) |
 |  |  |
|
[»] scaffold0182 (1 HSPs) |
 |  |  |
|
[»] scaffold0098 (1 HSPs) |
 |  |  |
|
[»] scaffold0050 (1 HSPs) |
 |  |  |
|
[»] scaffold0027 (1 HSPs) |
 |  |  |
|
[»] scaffold0378 (3 HSPs) |
 |  |  |
|
[»] scaffold0605 (1 HSPs) |
 |  |  |
|
[»] scaffold0243 (1 HSPs) |
 |  |  |
|
[»] scaffold0101 (1 HSPs) |
 |  |  |
|
[»] scaffold0094 (1 HSPs) |
 |  |  |
|
[»] scaffold0032 (1 HSPs) |
 |  |  |
|
[»] scaffold0503 (2 HSPs) |
 |  |  |
|
[»] scaffold0441 (1 HSPs) |
 |  |  |
|
[»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 24)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 144 - 241
Target Start/End: Complemental strand, 2156582 - 2156480
Alignment:
Q |
144 |
aaccactcactttgttgccccctttctgcatcttttctcgcacacgattcttaacata-----ttatttgaatctgagctttccaattcttcctatttga |
238 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
2156582 |
aaccactcactttgtcgccccctttctgcatcttttcttgcacacgattcttaacatattttcttatttgaatctgagctttccaattcttcctatttga |
2156483 |
T |
 |
Q |
239 |
tct |
241 |
Q |
|
|
||| |
|
|
T |
2156482 |
tct |
2156480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 6 - 70
Target Start/End: Original strand, 16825615 - 16825679
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
16825615 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacagt |
16825679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 16816860 - 16816923
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
16816860 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
16816923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 8275566 - 8275504
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
8275566 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
8275504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 27509435 - 27509373
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
T |
27509435 |
agtctgatccgagttcggagacgagtgtcagtgggaccttaggtcaaaatttggggtatgaca |
27509373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 30437360 - 30437422
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
T |
30437360 |
agtctgatccgagttcggagacgtgtgtcggtgggaccttaggtcaaaatttggggtatgaca |
30437422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 24143569 - 24143632
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
24143569 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaaattggggtatgacag |
24143632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 27517372 - 27517309
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
27517372 |
agtctgatccgagtttggagacgagtgtcagtgggaccttaggtcaaaatttggggtatgacag |
27517309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 18965536 - 18965598
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
18965536 |
agtctggtccgagttcggaaacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
18965598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 24150059 - 24150121
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
24150059 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaaattggggtatgaca |
24150121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 131
Target Start/End: Complemental strand, 2156681 - 2156642
Alignment:
Q |
92 |
cttccttgaaacgtttttctcttcaatcttgctccgtgca |
131 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2156681 |
cttccttgaaacgtttttctcttcaatcttgctccgtgca |
2156642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 25 - 71
Target Start/End: Complemental strand, 19169149 - 19169103
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagta |
71 |
Q |
|
|
||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
T |
19169149 |
gacgtgtgtcagtgggaccttaggtcaaaaattggggtatgacagta |
19169103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 623847 - 623887
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
623847 |
gtgtcagtgggatcttgggtcaaaatttggggtatgacagt |
623887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 615946 - 615985
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
615946 |
gtgtcagtgggatcttgggtcaaaatttggggtatgacag |
615985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 20048767 - 20048807
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||||||||||||| |||||||| ||||||||||||||| |
|
|
T |
20048767 |
gtgtcagtgggatcttgggtcaaaaattggggtatgacagt |
20048807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 9131732 - 9131771
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||| ||||||||||||||||||||||| |
|
|
T |
9131732 |
gtgtcaatgggatcttgggtcaaaatttggggtatgacag |
9131771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 20040961 - 20041000
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
20040961 |
gtgtcagtgggatcttgggtcaaaaattggggtatgacag |
20041000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 9145556 - 9145594
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||| |||||||||||||||||||||| |
|
|
T |
9145556 |
gtgtcaatgggatcttgggtcaaaatttggggtatgaca |
9145594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 18436748 - 18436710
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||| |||||||||||||||||||| ||||||||||||| |
|
|
T |
18436748 |
gtgttagtgggatcttaggtcaaaaattggggtatgaca |
18436710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 29 - 70
Target Start/End: Original strand, 18961023 - 18961064
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||||| |
|
|
T |
18961023 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacagt |
18961064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 32 - 69
Target Start/End: Original strand, 20051004 - 20051041
Alignment:
Q |
32 |
gtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||| |||||||||||| |||||||||||||| |
|
|
T |
20051004 |
gtcagtgggaacttaggtcaaaaattggggtatgacag |
20051041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 32 - 73
Target Start/End: Original strand, 20058867 - 20058908
Alignment:
Q |
32 |
gtcagtgggatcttaggtcaaaatttggggtatgacagtact |
73 |
Q |
|
|
|||||||||| |||||||||||| ||||||||||||| |||| |
|
|
T |
20058867 |
gtcagtgggaccttaggtcaaaaattggggtatgacaatact |
20058908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 12391096 - 12391056
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||| ||||| |||||||||||||| |||||||||||||| |
|
|
T |
12391096 |
tgtgttagtggtatcttaggtcaaaaattggggtatgacag |
12391056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 19719875 - 19719835
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
19719875 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
19719835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 28)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 6 - 70
Target Start/End: Original strand, 5651827 - 5651891
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
5651827 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacagt |
5651891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 8812665 - 8812602
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
8812665 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
8812602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 15529045 - 15529108
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
15529045 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
15529108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 8804265 - 8804203
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
8804265 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
8804203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 15537735 - 15537797
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
15537735 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
15537797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 21607514 - 21607452
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
21607514 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
21607452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 21616142 - 21616079
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
T |
21616142 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtataacag |
21616079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 46385361 - 46385298
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
46385361 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
46385298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 46371234 - 46371172
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
46371234 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
46371172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 6201629 - 6201566
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
T |
6201629 |
agtctggtccgagttcggagacgtgtgtcagtgtgaccttaggtcaaaatttggggtatgacag |
6201566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 68
Target Start/End: Original strand, 11629993 - 11630048
Alignment:
Q |
13 |
tccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
11629993 |
tccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
11630048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 6194046 - 6193984
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
T |
6194046 |
agtctggtccgagttcggagacgtgtgtcagtgtgaccttaggtcaaaatttggggtatgaca |
6193984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 52501396 - 52501334
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||| |
|
|
T |
52501396 |
agtctgatccgagttcggagacgtgtgtcggtaggaccttaggtcaaaatttggggtatgaca |
52501334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 33814572 - 33814633
Alignment:
Q |
7 |
gtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||| ||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||| |
|
|
T |
33814572 |
gtctggtccgagttcggagacgtgtatcagtgggaccttaggtcaaaaattggggtatgaca |
33814633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 37256122 - 37256161
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
37256122 |
gtgtcagtgggatcttgggtcaaaatttggggtatgacag |
37256161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 20604017 - 20604055
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
T |
20604017 |
gtgtcagtgggatcttgggtcaaaatttggggtatgaca |
20604055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 37265958 - 37265996
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
T |
37265958 |
gtgtcagtgggatcttgggtcaaaatttggggtatgaca |
37265996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Complemental strand, 8623723 - 8623684
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
8623723 |
gtgtcagtgggatcttgggtcaaaaattggggtatgacag |
8623684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 46393391 - 46393430
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
46393391 |
gtgtcagtgggatcttgggtcaaaaattggggtatgacag |
46393430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 69
Target Start/End: Original strand, 5945984 - 5946026
Alignment:
Q |
27 |
cgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||| |||||||| |||||||||||||| |
|
|
T |
5945984 |
cgtgtgtcagtgagatcttgggtcaaaaattggggtatgacag |
5946026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 70
Target Start/End: Original strand, 13509443 - 13509481
Alignment:
Q |
32 |
gtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||||||| ||||||||||||||| |||||||||||| |
|
|
T |
13509443 |
gtcagtgggaccttaggtcaaaatttagggtatgacagt |
13509481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 18706305 - 18706267
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
18706305 |
gtgtcagtgggaccttaggtcaaaaattggggtatgaca |
18706267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 46401139 - 46401177
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
46401139 |
gtgtcagtgggatcttgggtcaaaaattggggtatgaca |
46401177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 27 - 68
Target Start/End: Original strand, 5960096 - 5960137
Alignment:
Q |
27 |
cgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| |||||| |||||||| ||||||||||||| |
|
|
T |
5960096 |
cgtgtgtcagtgagatcttgggtcaaaaattggggtatgaca |
5960137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 4313621 - 4313661
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
4313621 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
4313661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 69
Target Start/End: Complemental strand, 8612657 - 8612621
Alignment:
Q |
33 |
tcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||| ||||||||||||| |||||||||||||| |
|
|
T |
8612657 |
tcagtgggctcttaggtcaaaaattggggtatgacag |
8612621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 73
Target Start/End: Complemental strand, 13086593 - 13086549
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacagtact |
73 |
Q |
|
|
||||| ||||||| |||||||||||| ||||||||||||| |||| |
|
|
T |
13086593 |
tgtgttagtgggaccttaggtcaaaaattggggtatgacactact |
13086549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 15610518 - 15610554
Alignment:
Q |
32 |
gtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||| |||||||||||| ||||||||||||| |
|
|
T |
15610518 |
gtcagtgggaccttaggtcaaaaattggggtatgaca |
15610554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 12)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 6 - 70
Target Start/End: Original strand, 22570897 - 22570961
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
22570897 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacagt |
22570961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 25926782 - 25926844
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
25926782 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
25926844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 5624205 - 5624268
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
5624205 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
5624268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 5638344 - 5638406
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
5638344 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
5638406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 68
Target Start/End: Original strand, 20979981 - 20980036
Alignment:
Q |
13 |
tccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
20979981 |
tccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
20980036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 22840171 - 22840214
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||| |||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
22840171 |
gacgcgtgtcagtgggaccttaggtcaaaaattggggtatgaca |
22840214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 20429391 - 20429353
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
20429391 |
gtgtcagtgggaccttaggtcaaaaattggggtatgaca |
20429353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 35 - 68
Target Start/End: Complemental strand, 20518314 - 20518281
Alignment:
Q |
35 |
agtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||| ||||||||||||| |
|
|
T |
20518314 |
agtgggatcttaggtcaaaaattggggtatgaca |
20518281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 1961677 - 1961637
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
1961677 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
1961637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 2336083 - 2336123
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
2336083 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
2336123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 13450071 - 13450035
Alignment:
Q |
32 |
gtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
T |
13450071 |
gtcagtgggaccttaggtcaaaatttagggtatgaca |
13450035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 19367514 - 19367474
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
19367514 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
19367474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 18)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 30365017 - 30365080
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30365017 |
agtctggtccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
30365080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 6113704 - 6113642
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
6113704 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
6113642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 30379081 - 30379143
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30379081 |
agtctggtccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
30379143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 5651530 - 5651592
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5651530 |
agtctggtccgagttcgaagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
5651592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 6 - 71
Target Start/End: Complemental strand, 4847232 - 4847167
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagta |
71 |
Q |
|
|
|||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
4847232 |
agtctggtccgagtccggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacagta |
4847167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 42631262 - 42631325
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
42631262 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaaattggggtatgacag |
42631325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 9474297 - 9474234
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
9474297 |
agtctggtccgagttcggagacgtgtgtcagtggagccttaggtcaaaatttggggtatgacag |
9474234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 16388538 - 16388601
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
T |
16388538 |
agtctggtccgagttcggggacgtgtgttagtgggaccttaggtcaaaatttggggtatgacag |
16388601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 9460507 - 9460445
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
9460507 |
agtctggtccgagttcggagacgtgtgtcagtggagccttaggtcaaaatttggggtatgaca |
9460445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 16402649 - 16402711
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
T |
16402649 |
agtctggtccgagttcggggacgtgtgttagtgggaccttaggtcaaaatttggggtatgaca |
16402711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 23878722 - 23878761
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
23878722 |
gtgtcagtgggatcttgggtcaaaatttggggtatgacag |
23878761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 69
Target Start/End: Complemental strand, 8817916 - 8817878
Alignment:
Q |
31 |
tgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
8817916 |
tgtcagtgggatcttgggtcaaaatttggggtatgacag |
8817878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 68
Target Start/End: Complemental strand, 8810102 - 8810065
Alignment:
Q |
31 |
tgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||| |
|
|
T |
8810102 |
tgtcagtgggatcttgggtcaaaatttggggtatgaca |
8810065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 69
Target Start/End: Complemental strand, 15683195 - 15683151
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||| |||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
15683195 |
gacgcgtgtcagtgggaccttaggtcaaaaattggggtatgacag |
15683151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 37 - 70
Target Start/End: Original strand, 7343972 - 7344005
Alignment:
Q |
37 |
tgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||||||||||||||| ||||||||||||||| |
|
|
T |
7343972 |
tgggatcttaggtcaaaaattggggtatgacagt |
7344005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 69
Target Start/End: Complemental strand, 12583659 - 12583627
Alignment:
Q |
37 |
tgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |
|
|
T |
12583659 |
tgggatcttaggtcaaaaattggggtatgacag |
12583627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 34132848 - 34132888
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
34132848 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
34132888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 34363163 - 34363207
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||| ||||||||||| |||| |||||||| |||||||||||||| |
|
|
T |
34363163 |
gacgcgtgtcagtggggtcttgggtcaaaaattggggtatgacag |
34363207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1634 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold1634
Description:
Target: scaffold1634; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 1059 - 997
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1059 |
agtctggtccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0064 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0064
Description:
Target: scaffold0064; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 9186 - 9248
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
9186 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
9248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 18433092 - 18433030
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
18433092 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
18433030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 23267930 - 23267992
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
23267930 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
23267992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 15707200 - 15707138
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
15707200 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
15707138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 39631527 - 39631590
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
T |
39631527 |
agtctggtccgagttcggagacgtgtgtcagtgagaccttaggtcaaaatttggggtatgacag |
39631590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 39641075 - 39641137
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
T |
39641075 |
agtctggtccgagttcggagacgtgtgtcagtgagaccttaggtcaaaatttggggtatgaca |
39641137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 12307699 - 12307738
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
12307699 |
gtgtcagtgggatcttgggtcaaaatttggggtatgacag |
12307738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 29 - 68
Target Start/End: Original strand, 32025680 - 32025719
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| ||||||||||||| ||||||||||||| |
|
|
T |
32025680 |
tgtgtcagtggggtcttaggtcaaaaattggggtatgaca |
32025719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 24487945 - 24487981
Alignment:
Q |
32 |
gtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||| |||||||||||| ||||||||||||| |
|
|
T |
24487945 |
gtcagtgggaccttaggtcaaaaattggggtatgaca |
24487981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 13)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 39649728 - 39649666
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
39649728 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
39649666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 12374616 - 12374553
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
T |
12374616 |
agtctggtccgagttcggagacgtgtgtcagtggaaccttaggtcaaaatttggggtatgacag |
12374553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 12388443 - 12388380
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
T |
12388443 |
agtctggtccgagttcggagacgtgtgtcagtggaaccttaggtcaaaatttggggtatgacag |
12388380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 44300020 - 44299959
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
44300020 |
agtctggtccgagttcggagac-tgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
44299959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 6 - 70
Target Start/End: Complemental strand, 22940247 - 22940183
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||||| | |||||||| |||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
T |
22940247 |
agtctggttcgagttcgaagacgtgtgtcagtgggacctttggtcaaaatttggggtatgacagt |
22940183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 22954142 - 22954079
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| | |||||||| |||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
22954142 |
agtctggttcgagttcgaagacgtgtgtcagtgggacctttggtcaaaatttggggtatgacag |
22954079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 22934284 - 22934222
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| | |||||||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
T |
22934284 |
agtctggttcgagttcgaagacgtgtgtcagtgggacctttggtcaaaatttggggtatgaca |
22934222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 29 - 68
Target Start/End: Complemental strand, 11873721 - 11873682
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| ||||||||||||| ||||||||||||| |
|
|
T |
11873721 |
tgtgtcagtggggtcttaggtcaaaaattggggtatgaca |
11873682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 45498997 - 45499040
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||| ||||||||||||| |||| |||||||| |
|
|
T |
45498997 |
gacgtgtgtcagtggggtcttaggtcaaaaattggagtatgaca |
45499040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 12370481 - 12370519
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
12370481 |
gtgtcagtgggatcttgggtcaaaaattggggtatgaca |
12370519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 22518990 - 22519028
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
22518990 |
gtgtcagtgggaccttaggtcaaaaattggggtatgaca |
22519028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 5871137 - 5871177
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
5871137 |
tgtgtcagtgggcccttaggtcaaaaattggggtatgacag |
5871177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 45489352 - 45489396
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||| ||| || |||||||||||| |||||||||||||| |
|
|
T |
45489352 |
gacgtgtgtcggtgtgaccttaggtcaaaaattggggtatgacag |
45489396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 32)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 7794350 - 7794287
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
7794350 |
agtctgatccgagttcggagacgcgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
7794287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 15779747 - 15779810
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
15779747 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
15779810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 17961936 - 17961873
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
17961936 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
17961873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 31525392 - 31525329
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
31525392 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
31525329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 7786500 - 7786438
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
T |
7786500 |
agtctgatccgagttcggagacgcgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
7786438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 15793982 - 15794044
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
15793982 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
15794044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 17948046 - 17947984
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
17948046 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
17947984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 31511268 - 31511206
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
31511268 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
31511206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 34314250 - 34314312
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
T |
34314250 |
agtctgatccgagttcggagacgtgtgtcggtgggaccttaggtcaaaatttggggtatgaca |
34314312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 12387255 - 12387318
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
12387255 |
agtctggtccgagttcggggacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
12387318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 21696134 - 21696071
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
21696134 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaaattggggtatgacag |
21696071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 36371292 - 36371355
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
T |
36371292 |
agtctggtccgagttcggagacgtgtgttagtgggaccttaggtcaaaatttggggtatgacag |
36371355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 36385220 - 36385283
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
T |
36385220 |
agtctggtccgagttcggagacgtgtgttagtgggaccttaggtcaaaatttggggtatgacag |
36385283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 36995955 - 36996018
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
T |
36995955 |
agtctggtccgagttcggagacgtgtgttagtgggaccttaggtcaaaatttggggtatgacag |
36996018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 37009893 - 37009956
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
T |
37009893 |
agtctggtccgagttcggagacgtgtgttagtgggaccttaggtcaaaatttggggtatgacag |
37009956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 21688215 - 21688153
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
21688215 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaaattggggtatgaca |
21688153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 72
Target Start/End: Original strand, 26553269 - 26553335
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagtac |
72 |
Q |
|
|
|||||| |||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
T |
26553269 |
agtctggtccgagttcggagaagtgtgtcagtgggaccttaggtcaaaaattggggtatgacagtac |
26553335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 5435728 - 5435791
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| |||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
5435728 |
agtctggtccgagttcggagatgtgtgtcagtgggacctttggtcaaaatttggggtatgacag |
5435791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 5449548 - 5449611
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| |||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
5449548 |
agtctggtccgagttcggagatgtgtgtcagtgggacctttggtcaaaatttggggtatgacag |
5449611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 12395948 - 12396010
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| |||||||| || ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
12395948 |
agtctggtccgagtttggggacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
12396010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 25450613 - 25450675
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
T |
25450613 |
agtctggtccgagttcagagacgtgtgtcagtgggacctttggtcaaaatttggggtatgaca |
25450675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 11939641 - 11939680
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
11939641 |
gtgtcagtgggatcttgggtcaaaatttggggtatgacag |
11939680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Complemental strand, 1805278 - 1805239
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
1805278 |
gtgtcagtgggatcttgggtcaaaaattggggtatgacag |
1805239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 7255096 - 7255135
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
7255096 |
gtgtcagtgggatcttgggtcaaaaattggggtatgacag |
7255135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 7262538 - 7262577
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
7262538 |
gtgtcagtgggatcttgggtcaaaaattggggtatgacag |
7262577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Complemental strand, 37048382 - 37048343
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||||||||||||||||||||||| || ||||||||||| |
|
|
T |
37048382 |
gtgtcagtgggatcttaggtcaaaaatttgggtatgacag |
37048343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 1797537 - 1797499
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
1797537 |
gtgtcagtgggatcttgggtcaaaaattggggtatgaca |
1797499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 69
Target Start/End: Complemental strand, 29901266 - 29901228
Alignment:
Q |
31 |
tgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
29901266 |
tgtcagtgggaccttaggtcaaaaattggggtatgacag |
29901228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 20092779 - 20092819
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
20092779 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
20092819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 20639889 - 20639929
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
20639889 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
20639929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 23577462 - 23577506
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||| |||||| ||||| |||||||||||| |||||||||||||| |
|
|
T |
23577462 |
gacgcgtgtcaatgggaccttaggtcaaaaattggggtatgacag |
23577506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 25526227 - 25526187
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
25526227 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
25526187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 20842674 - 20842737
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
T |
20842674 |
agtctgatccgagttcggagacgtgtgtcagtgggaccttaggtaaaaatttggggtatgacag |
20842737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 22712487 - 22712424
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
T |
22712487 |
agtctgatccgagttcggagacgtgtgtcggtgggaccttaggtcaaaatttggggtatgacag |
22712424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 18389062 - 18389124
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
18389062 |
agtctgatccgagttcggagacgtgtgtcagtgggactttaggtcaaaatttggggtatgaca |
18389124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 22703516 - 22703454
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
T |
22703516 |
agtctgatccgagttcggagacgtgtgtcggtgggaccttaggtcaaaatttggggtatgaca |
22703454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 41149041 - 41148979
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
41149041 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
41148979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 6 - 70
Target Start/End: Complemental strand, 13100732 - 13100668
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
13100732 |
agtctgatctgagttcggagacgtgtgtcagtggggccttaggtcaaaatttggggtatgacagt |
13100668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 12427198 - 12427136
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
12427198 |
agtctggtccgagttcggggacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
12427136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 3836814 - 3836868
Alignment:
Q |
14 |
ccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
T |
3836814 |
ccgagttcggagacgtgtgtcagtggaaccttaggtcaaaatttggggtatgaca |
3836868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 15580511 - 15580547
Alignment:
Q |
32 |
gtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||| |
|
|
T |
15580511 |
gtcagtgggatcttaggtcaaaaattggggtatgaca |
15580547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 15880067 - 15880111
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||| |||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
15880067 |
gacgcgtgtcagtgggaccttaggtcaaaaattggggtatgacag |
15880111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 16720798 - 16720842
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||||||||||| || ||||||||||||| |||||||||||||| |
|
|
T |
16720798 |
gacgtgtgtcagtcgggtcttaggtcaaaaattggggtatgacag |
16720842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 16728821 - 16728864
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||| |||||||| |||| ||||||||||||| |
|
|
T |
16728821 |
gacgtgtgtcagtggggtcttaggtaaaaaattggggtatgaca |
16728864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Complemental strand, 39534213 - 39534174
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
39534213 |
gtgtcagtgggatcttgggtcaaaaattggggtatgacag |
39534174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 55793256 - 55793294
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
55793256 |
gtgtcagtgggaccttaggtcaaaaattggggtatgaca |
55793294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 3382471 - 3382511
Alignment:
Q |
29 |
tgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
3382471 |
tgtgtcagtggggccttaggtcaaaaattggggtatgacag |
3382511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 69
Target Start/End: Complemental strand, 55788818 - 55788786
Alignment:
Q |
37 |
tgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |
|
|
T |
55788818 |
tgggatcttaggtcaaaaattggggtatgacag |
55788786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 20274 - 20212
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
20274 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
20212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 34014 - 33952
Alignment:
Q |
7 |
gtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
34014 |
gtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacag |
33952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 38100 - 38140
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
||||||||||| |||||||||||| ||||||||||||||| |
|
|
T |
38100 |
gtgtcagtggggccttaggtcaaaaattggggtatgacagt |
38140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1719 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold1719
Description:
Target: scaffold1719; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 1 - 58
Alignment:
Q |
13 |
tccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
1 |
tccgagttcggagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgacagt |
58 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0755 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0755
Description:
Target: scaffold0755; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 1025 - 962
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
1025 |
agtctgatctgagttcggagacgtgtgtcagtggggccttaggtcaaaatttggggtatgacag |
962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 17776 - 17839
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
17776 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaaattggggtatgacag |
17839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 25695 - 25757
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
25695 |
agtctggtccgagttcggagacgtgtgtcagtgggaccttaggtcaaaaattggggtatgaca |
25757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 202678 - 202741
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
202678 |
agtctggtccgagttcggagacgtgtgtcagtgggacctttggtcaaaatttggggtatgacag |
202741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 208755 - 208818
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||| | |||||||| ||| |||||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
208755 |
agtctggtacgagttcgaagaagtgtgtcagtgggacctttggtcaaaatttggggtatgacag |
208818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0431 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0431
Description:
Target: scaffold0431; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Original strand, 2777 - 2839
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
2777 |
agtctggtccgagttcggggacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
2839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 1777 - 1715
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
1777 |
agtctggtccgagttcagagacgtgtgtcagtgggaccttaggtcaaaatttggggtatgaca |
1715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 53051 - 52989
Alignment:
Q |
6 |
agtctgatccgagttcggagacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||| |||||||||||||||| |||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
53051 |
agtctggtccgagttcggagacgcgtgtcagtgggatcttgggtcaaaaattggggtatgaca |
52989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 41287 - 41330
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
41287 |
gacgcgtgtcagtgggatcttaggtcaaaaattggggtatgaca |
41330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 417 - 455
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
T |
417 |
gtgtcagtgggatcttgggtcaaaatttggggtatgaca |
455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0378 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: scaffold0378
Description:
Target: scaffold0378; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 69
Target Start/End: Complemental strand, 813 - 769
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||| |||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
813 |
gacgcgtgtcagtgggaccttaggtcaaaaattggggtatgacag |
769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0378; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 3374 - 3336
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
3374 |
gtgtcagtgggaccttaggtcaaaaattggggtatgaca |
3336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0378; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 15854 - 15816
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
15854 |
gtgtcagtgggaccttaggtcaaaaattggggtatgaca |
15816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0605 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0605
Description:
Target: scaffold0605; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 9365 - 9404
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
9365 |
gtgtcagtgggaacttaggtcaaaaattggggtatgacag |
9404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0243 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0243
Description:
Target: scaffold0243; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Complemental strand, 20830 - 20791
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||||| |||| |||||||||||||| |
|
|
T |
20830 |
gtgtcagtgggatcttaggtaaaaaattggggtatgacag |
20791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0101 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0101
Description:
Target: scaffold0101; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 16560 - 16603
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||| |||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
16560 |
gacgcgtgtcagtgggaccttaggtcaaaaattggggtatgaca |
16603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 69
Target Start/End: Original strand, 30727 - 30766
Alignment:
Q |
30 |
gtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
30727 |
gtgtcagtgggaccttaggtcaaaaattggggtatgacag |
30766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 25 - 70
Target Start/End: Original strand, 29135 - 29180
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacagt |
70 |
Q |
|
|
|||| |||||||||||| |||||||||||| |||| |||||||||| |
|
|
T |
29135 |
gacgcgtgtcagtgggaccttaggtcaaaaattggagtatgacagt |
29180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0503 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: scaffold0503
Description:
Target: scaffold0503; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 1939 - 1983
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||| ||||||||| || |||||||||||| |||||||||||||| |
|
|
T |
1939 |
gacgcgtgtcagtgagaccttaggtcaaaaattggggtatgacag |
1983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0503; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 69
Target Start/End: Original strand, 6506 - 6550
Alignment:
Q |
25 |
gacgtgtgtcagtgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||| ||||||||| || |||||||||||| |||||||||||||| |
|
|
T |
6506 |
gacgcgtgtcagtgagaccttaggtcaaaaattggggtatgacag |
6550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0441 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0441
Description:
Target: scaffold0441; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 2507 - 2471
Alignment:
Q |
32 |
gtcagtgggatcttaggtcaaaatttggggtatgaca |
68 |
Q |
|
|
|||||||||| |||||||||||| ||||||||||||| |
|
|
T |
2507 |
gtcagtgggaccttaggtcaaaaattggggtatgaca |
2471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 69
Target Start/End: Complemental strand, 304516 - 304484
Alignment:
Q |
37 |
tgggatcttaggtcaaaatttggggtatgacag |
69 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |
|
|
T |
304516 |
tgggatcttaggtcaaaaattggggtatgacag |
304484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University