View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10078_high_17 (Length: 241)
Name: NF10078_high_17
Description: NF10078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10078_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 125 - 224
Target Start/End: Complemental strand, 36049088 - 36048989
Alignment:
Q |
125 |
tttttcacatggatcaaaagaagaagaaaacaataactaccttccataggctgatgattgttgttctcaggcaaatcagcgtgtggcacgagcacttctt |
224 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
36049088 |
tttttcacatggatcaaaaaaagaagaaaacaataactaccttccataggctgatgattgttgttctcgggcaaatcagcgtgtggcacgagcacttctt |
36048989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 36049212 - 36049143
Alignment:
Q |
1 |
tgtcctcacaatccaaaaactatgttgtaacacgggggaatgggatcttttgaagcaattcaattacatc |
70 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
36049212 |
tgtcttcacaatccaaaaactatgttgtaacacgggggaatgggatcttttgaagcaatttaattacatc |
36049143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University