View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10078_high_8 (Length: 397)
Name: NF10078_high_8
Description: NF10078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10078_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 206 - 271
Target Start/End: Original strand, 27141890 - 27141955
Alignment:
Q |
206 |
tattcttaatttaaagcctaagtatggtggtttaattgttgtctcagagtttatgaataatatgga |
271 |
Q |
|
|
|||| |||||||||||||||| ||||||||||| |||||||| ||| ||| ||||||||||||||| |
|
|
T |
27141890 |
tatttttaatttaaagcctaaatatggtggttttattgttgtttcacagtatatgaataatatgga |
27141955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 345 - 378
Target Start/End: Complemental strand, 28704131 - 28704098
Alignment:
Q |
345 |
atgaagtgattgagttgttttctcaatgggatca |
378 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
28704131 |
atgaagtgattgagttgttttctcaatgggatca |
28704098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 378
Target Start/End: Complemental strand, 26907390 - 26907354
Alignment:
Q |
342 |
aagatgaagtgattgagttgttttctcaatgggatca |
378 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| |
|
|
T |
26907390 |
aagatgaagtgattgaggtgttttctcaatgggatca |
26907354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 322 - 378
Target Start/End: Complemental strand, 2871843 - 2871786
Alignment:
Q |
322 |
ttagacaattaa-aatttactaagatgaagtgattgagttgttttctcaatgggatca |
378 |
Q |
|
|
||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
2871843 |
ttagacagttaacaatttactaagatgaagtgattgagttgttttctcaattggatca |
2871786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 113 - 168
Target Start/End: Complemental strand, 41821397 - 41821342
Alignment:
Q |
113 |
acccttgttgtctacaagaatagctgctcttatatcattattgaacatgaaaaaag |
168 |
Q |
|
|
||||||||||||| ||||||||||||||||| |||||||| | |||| |||||||| |
|
|
T |
41821397 |
acccttgttgtctgcaagaatagctgctcttctatcattagtaaacaggaaaaaag |
41821342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University