View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10078_low_15 (Length: 317)
Name: NF10078_low_15
Description: NF10078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10078_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 22 - 307
Target Start/End: Complemental strand, 28193470 - 28193189
Alignment:
| Q |
22 |
aagcccttcattctttcttcacaatatacaacaatattttaaaaatcgaatcgaattagaatgttaaacgggtcgaaccctaaaccgattattgtgtaca |
121 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
28193470 |
aagcccttcattcattcttcacaatatagaacaatattttaaaaatcaaatcgaattagaatgttaaacgggtcgaaccctaaacc-aatattgtgtaca |
28193372 |
T |
 |
| Q |
122 |
tttcagttatctgagcggttcaatcacaattttatcagggttataacgatttaaagcaattattaaaccattattttattcatatgtctcgtaagtttga |
221 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||| || ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28193371 |
ttttagttatctgagtggttcaatcacaattttatctggattatagtgatttaaagca---attaaaccattattttattcatatgtctcgtaagtttga |
28193275 |
T |
 |
| Q |
222 |
tgtccgattcaatttttaaaatattgatatagaacca-tttttgtccccgattaggttagatctgtgtaactaactgtctgtctgtg |
307 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28193274 |
tgtccgatttgattttt-taatattgatatagaaccattttttgtcccccattaggttagatttgtgtaactaactgtctgtctgtg |
28193189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University