View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10078_low_21 (Length: 253)
Name: NF10078_low_21
Description: NF10078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10078_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 48 - 240
Target Start/End: Complemental strand, 29259509 - 29259320
Alignment:
| Q |
48 |
cttcttccttttgttgctacaagataggtgggtcctcttccaactatacatgtttgtttgtactttgtagttttggctttggggtggggaagggaccact |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29259509 |
cttcttccttttgttgctacaagataggtgggtcctcttccaactatacatgtttgtttgtactttgtagttttggctttggggtggggaagggaccact |
29259410 |
T |
|
| Q |
148 |
ttacacatattaggctatgctcgtactactgtagtactgaccttccaacttctactatttgatgttcccacattttcttttgcctatgcttct |
240 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29259409 |
ttacacatattaggctatactcg---tactgtagtaatgaccttccaacttctacaatttgatgttcccacattttcttttgcccatgcttct |
29259320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University