View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10079_high_2 (Length: 236)
Name: NF10079_high_2
Description: NF10079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10079_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 3263255 - 3263395
Alignment:
| Q |
1 |
cacccaagattgaatcaattctatcttcattttatttcgtatccctttttagagtaaaattttgtttgcacttgtaagtgtctcacactaacatgacaca |
100 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3263255 |
cacccaagattgaatcagttctatcttgattttatttcgtatacctttttagagtaacattttgtttgcacttgtaagtgtctcacactaccatgacaca |
3263354 |
T |
|
| Q |
101 |
tgtcattacattcaattacttctatcatctcaaattagtat |
141 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3263355 |
tgtcgttacattcaattacttctatcatctcaaattagtat |
3263395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University