View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10079_low_11 (Length: 237)
Name: NF10079_low_11
Description: NF10079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10079_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 219
Target Start/End: Complemental strand, 34640471 - 34640256
Alignment:
| Q |
12 |
agcagagagatcgaatatttgatacattctactataaacggc--------acccatattactgaaatgttcctttgtagaccaaaaaactgatttcattt |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34640471 |
agcatagagatcgaatatttgatacattctactataaacggtgtatcccaacccatattactgaaatgttcctttgtagaccaaaaaactgatttcattt |
34640372 |
T |
|
| Q |
104 |
tagataatttactcnnnnnnnnttgtattgttccaaaatgatattaattgcttctttattttacttgtattatacttgtatcacataccaaaattggatc |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34640371 |
tagataatttactttaaaaaaattgtattgttccaaaatgatattaattgcttctttattttacttgtattatacttgtattacataccaaaattggatc |
34640272 |
T |
|
| Q |
204 |
attttagatacctctg |
219 |
Q |
| |
|
||||||||| |||||| |
|
|
| T |
34640271 |
attttagatgcctctg |
34640256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University