View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10079_low_6 (Length: 344)

Name: NF10079_low_6
Description: NF10079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10079_low_6
NF10079_low_6
[»] chr5 (2 HSPs)
chr5 (201-326)||(24428371-24428496)
chr5 (16-109)||(24428207-24428303)
[»] scaffold0790 (2 HSPs)
scaffold0790 (11-109)||(251-349)
scaffold0790 (285-335)||(445-495)
[»] chr6 (1 HSPs)
chr6 (11-72)||(33985988-33986049)
[»] chr2 (1 HSPs)
chr2 (7-49)||(32284991-32285033)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 201 - 326
Target Start/End: Original strand, 24428371 - 24428496
Alignment:
201 tctttgacgatttcagtttcagtgttcctgaggctgcgccttttgctgtcgttctcaaattcacagctgaaggattcaaagttcctccacagaccagcgc 300  Q
    ||||| ||||||||||||||||||||||||| ||||| |||||| | | ||||||||||||  ||||||||| |||||||||||| ||||||||||||||    
24428371 tctttcacgatttcagtttcagtgttcctgaagctgcaccttttaccgccgttctcaaatttgcagctgaagaattcaaagttcccccacagaccagcgc 24428470  T
301 tattataaccaatggtaatttctttc 326  Q
    |||||| |||||||||||||||||||    
24428471 tattatcaccaatggtaatttctttc 24428496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 16 - 109
Target Start/End: Original strand, 24428207 - 24428303
Alignment:
16 gagtttttgttggtggtgaatatgtgga---gtggtggaaaggtttctttcaaagtcactctcacttccggtccaaaactacccttcaaagtgtatg 109  Q
    ||||||| ||||||||||||||||  ||   ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
24428207 gagttttagttggtggtgaatatggcgaacggtggtggaaaggtttctttcaaagtcactctcacttccgatccaaaactacccttcaaagtgtatg 24428303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0790 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: scaffold0790
Description:

Target: scaffold0790; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 11 - 109
Target Start/End: Original strand, 251 - 349
Alignment:
11 cgtgagagtttttgttggtggtgaatatgtggagtggtggaaaggtttctttcaaagtcactctcacttccggtccaaaactacccttcaaagtgtatg 109  Q
    |||||||||||||||||||||||||||||||||  ||||||||||||| ||||||| ||||||||||||||| | ||||||||||||||||||||||||    
251 cgtgagagtttttgttggtggtgaatatgtggaacggtggaaaggtttatttcaaactcactctcacttccgattcaaaactacccttcaaagtgtatg 349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0790; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 285 - 335
Target Start/End: Original strand, 445 - 495
Alignment:
285 ctccacagaccagcgctattataaccaatggtaatttctttcatcatcatt 335  Q
    ||||||| | |||||||||||| ||||||||||||||||||||||||||||    
445 ctccacaaatcagcgctattatcaccaatggtaatttctttcatcatcatt 495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 33986049 - 33985988
Alignment:
11 cgtgagagtttttgttggtggtgaatatgtggagtggtggaaaggtttctttcaaagtcact 72  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||    
33986049 cgtgagagtttttgttggtggtgaatatgtggaacggtggaaaggtttctttcaaagtcact 33985988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 32284991 - 32285033
Alignment:
7 gtatcgtgagagtttttgttggtggtgaatatgtggagtggtg 49  Q
    ||||||||||||||||||||||||||||||||||||| |||||    
32284991 gtatcgtgagagtttttgttggtggtgaatatgtggaatggtg 32285033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University