View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10079_low_6 (Length: 344)
Name: NF10079_low_6
Description: NF10079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10079_low_6 |
 | |
|
| [»] scaffold0790 (2 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 201 - 326
Target Start/End: Original strand, 24428371 - 24428496
Alignment:
| Q |
201 |
tctttgacgatttcagtttcagtgttcctgaggctgcgccttttgctgtcgttctcaaattcacagctgaaggattcaaagttcctccacagaccagcgc |
300 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||| |||||| | | |||||||||||| ||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
24428371 |
tctttcacgatttcagtttcagtgttcctgaagctgcaccttttaccgccgttctcaaatttgcagctgaagaattcaaagttcccccacagaccagcgc |
24428470 |
T |
|
| Q |
301 |
tattataaccaatggtaatttctttc |
326 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
24428471 |
tattatcaccaatggtaatttctttc |
24428496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 16 - 109
Target Start/End: Original strand, 24428207 - 24428303
Alignment:
| Q |
16 |
gagtttttgttggtggtgaatatgtgga---gtggtggaaaggtttctttcaaagtcactctcacttccggtccaaaactacccttcaaagtgtatg |
109 |
Q |
| |
|
||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24428207 |
gagttttagttggtggtgaatatggcgaacggtggtggaaaggtttctttcaaagtcactctcacttccgatccaaaactacccttcaaagtgtatg |
24428303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 11 - 109
Target Start/End: Original strand, 251 - 349
Alignment:
| Q |
11 |
cgtgagagtttttgttggtggtgaatatgtggagtggtggaaaggtttctttcaaagtcactctcacttccggtccaaaactacccttcaaagtgtatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
251 |
cgtgagagtttttgttggtggtgaatatgtggaacggtggaaaggtttatttcaaactcactctcacttccgattcaaaactacccttcaaagtgtatg |
349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0790; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 285 - 335
Target Start/End: Original strand, 445 - 495
Alignment:
| Q |
285 |
ctccacagaccagcgctattataaccaatggtaatttctttcatcatcatt |
335 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
445 |
ctccacaaatcagcgctattatcaccaatggtaatttctttcatcatcatt |
495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 33986049 - 33985988
Alignment:
| Q |
11 |
cgtgagagtttttgttggtggtgaatatgtggagtggtggaaaggtttctttcaaagtcact |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33986049 |
cgtgagagtttttgttggtggtgaatatgtggaacggtggaaaggtttctttcaaagtcact |
33985988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 32284991 - 32285033
Alignment:
| Q |
7 |
gtatcgtgagagtttttgttggtggtgaatatgtggagtggtg |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32284991 |
gtatcgtgagagtttttgttggtggtgaatatgtggaatggtg |
32285033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University