View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_28 (Length: 309)
Name: NF10080_high_28
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 18 - 164
Target Start/End: Original strand, 21932725 - 21932871
Alignment:
| Q |
18 |
gttgtctatcttctgcttatgcttaatatttttcacttctttaaaccattgcttagctaaagacaccataaccattaacaatttgttaagagatggagga |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21932725 |
gttgtctatcttctgtttatgcttaatatttttcacttcttttaaccattgtttagcaaaagataccataaccattaacaatttgataagagatggagga |
21932824 |
T |
|
| Q |
118 |
aaagatactctcatttcagcaggagaaaactttgaacttggattttt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21932825 |
aaagatactctcatttcagcaggagaaaattttgaacttggattttt |
21932871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 195 - 241
Target Start/End: Complemental strand, 26633242 - 26633196
Alignment:
| Q |
195 |
gactagaattttcaaaatcaataacttctaaaggaaaactgttccag |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
26633242 |
gactagaattttcaaaatcaataacttctaaaggaaacctgatccag |
26633196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 195 - 231
Target Start/End: Original strand, 16935601 - 16935637
Alignment:
| Q |
195 |
gactagaattttcaaaatcaataacttctaaaggaaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16935601 |
gactagaattttcaaaatcaataacttctaaaggaaa |
16935637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University