View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_33 (Length: 291)
Name: NF10080_high_33
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10080_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 9362759 - 9362498
Alignment:
Q |
18 |
gttcttgtttatttcagggtggcatgtcatgtcaccctcgctcttgttgcagcacnnnnnnngaccctacacctgcacacatcctttattgacgaccaga |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
9362759 |
gttcttgtttatttcagggtggcatgtcatgtcaccctcgctcttgttgcagcacaaaaaaagaccctacacctgcacacatcctttattgacgaccaga |
9362660 |
T |
 |
Q |
118 |
gttttaataatgcatctgttaggaaaactatgcctcaatttccttcctaccctcagatctcataaatttaaaagtctactattgttgtnnnnnnnnttct |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
T |
9362659 |
gttttaataatgcatctgttaggaaaactatgcctcaatttccttcctaccctcagatctcataaatgtaaaagtctactattgttgtaaaaaaaattct |
9362560 |
T |
 |
Q |
218 |
catttcagattttagaaacaaaattttttcccattgccactcaaacaaagctccatcttctc |
279 |
Q |
|
|
||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||| |
|
|
T |
9362559 |
catttcagattttagaaacaaaaacttctcccattgccactcaaccaaagctccatcttctc |
9362498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University