View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_35 (Length: 287)
Name: NF10080_high_35
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 14 - 271
Target Start/End: Complemental strand, 14361992 - 14361735
Alignment:
| Q |
14 |
agagatcaaaagctaagagagcactacgttccctaggtataggaattgcaattccaattgctctcacattgacaataatcatcctctttggatcaggcag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361992 |
agagatcaaaagctaagagagcactacgttccctaggtataggaattgcaattcccattgctctcacattgacaataatcatcctctttggatcaggcag |
14361893 |
T |
|
| Q |
114 |
aaagtacaatgtcttagccaaaccattttggtttgcaccactttggtatattcatttagccacgttgggttcatctttcttcatgggtctagctgcatgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14361892 |
aaagtacaatgtcttagccaaaccattttggtttgcaccactttggtatattcatttagccacgttgggttcatctttcttcatgggtctagctgcttgg |
14361793 |
T |
|
| Q |
214 |
ttagtttgggctgatggtggatttcaaggtgaaacagatgcattgtctttctatatag |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14361792 |
ttagtttgggctgatggtggatttcaaggtgaaacagatgcattgtctttctatatag |
14361735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University