View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_38 (Length: 280)
Name: NF10080_high_38
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 17277627 - 17277371
Alignment:
| Q |
19 |
atttccacactaccaaatcaacaaaaactttaaaaacannnnnnnnctttctattttgtaagaagtaattctttgttagggtttagtgtgtgaaacctcg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17277627 |
atttccacactaccaaatcaacaaaaactttaaaaacattttttttctttctattttgtaagaagtaattctttgttagggtttagtgtgtgaaacctcg |
17277528 |
T |
 |
| Q |
119 |
gcggcatctttatagtacataaacggaggcaacctttctcttccttttgctccgggcaagcctcccggtcatgaggccactgtaactaccaccagaagta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17277527 |
gcggcatctttatagtacataaacggaggcaacctttctcttccttttgctccgggcaagcctcccggtcatgaggccactgtaactaccaccagaagta |
17277428 |
T |
 |
| Q |
219 |
cggccaaacctcccatttagaggccacaccttccaaaatctttcttcctttgcttct |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17277427 |
cggccaaacctcccatttagaggccacaccttccaaaatctttcttcctttgtttct |
17277371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University