View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_42 (Length: 267)
Name: NF10080_high_42
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_high_42 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 267
Target Start/End: Complemental strand, 37861226 - 37860975
Alignment:
| Q |
16 |
gacatcaagtggataaaggttcgacttttggctcctgcgtatggaaagatttcagttgggagtggagaacattattttttggttactatgttataggtac |
115 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37861226 |
gacattaagtggatagaggttcgacttttggctcctgcgtatggaaagatttcagttgggagtggagaacattattttttggttactatgttataggtac |
37861127 |
T |
 |
| Q |
116 |
aaaactttcactgtcgtttaatagcgatcaatctctgtcgaggaacttgtgttgtgtcacacaatgtgataacgatgttatttatatttggtcaagatag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37861126 |
gaaactttcactgtcgtttaatagcgatcaatctctgtcgaggaacttgtgttgtgtcacacaatgtgataacgatgttatttatatttggtcaagatag |
37861027 |
T |
 |
| Q |
216 |
ttcccagtacccttgttgcaatttgtttatgttattcgagcaagtatgattc |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37861026 |
ttcccagtacccttgttgcaatttgtttatgttattcgagcaagtatgattc |
37860975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University