View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_43 (Length: 258)
Name: NF10080_high_43
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10080_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 122 - 186
Target Start/End: Original strand, 36680082 - 36680146
Alignment:
Q |
122 |
tgatgtcagtatgtagtagctctgaacacccggcattgagaacttcctttgcttgctctgtctgt |
186 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
36680082 |
tgatgtcagtatgtagtagctctgaacacccggcgttgagaacttcctttgcttgctctgtctgt |
36680146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 14 - 124
Target Start/End: Original strand, 36686625 - 36686740
Alignment:
Q |
14 |
aagcagagaacttacagaaataaggagaaacataggaaacgatacaattaacgcatgaaagagag------aaatgaagaataacacgtgaccattttta |
107 |
Q |
|
|
|||||||||||||| | ||||||||| || || ||||||||||| ||||| ||| ||||| | || |||||||||||||||||||||||||| || |
|
|
T |
36686625 |
aagcagagaacttatacaaataaggataagcagaggaaacgataaaatta-cgcgtgaaacacagttacacaaatgaagaataacacgtgaccatttata |
36686723 |
T |
 |
Q |
108 |
aacaacattccatgtga |
124 |
Q |
|
|
||||||||||||||||| |
|
|
T |
36686724 |
aacaacattccatgtga |
36686740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University