View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_56 (Length: 237)
Name: NF10080_high_56
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_high_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 4334888 - 4335068
Alignment:
| Q |
18 |
aatttggagttttatttttcgtatttgagttgtttatacttgtatctattggtttgagtgatattatttggacaatgtatgttggcatgnnnnnnntgtc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4334888 |
aatttggagttttatttttcgtatttgagttgtttatacttgtatctattggtttgagtgatattatttggacaatgtatgttggcatgaaaaaaatgtc |
4334987 |
T |
|
| Q |
118 |
tgtgtctttggaaatattttatcatcactctcatggttggtgacacgttgcaattgcttctgtttttctttttatgcttat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4334988 |
tgtgtctttggaaatattttatcatcactctcatggttggtgacacgttgcaattgcttctgtttttctttttatgcttat |
4335068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University