View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_57 (Length: 237)
Name: NF10080_high_57
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_high_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 88 - 214
Target Start/End: Complemental strand, 45667047 - 45666921
Alignment:
| Q |
88 |
cctggattttcttcaggtttattactaagtattcctgtgaatggtatctccttttccatgtataatgatgatccatgccgtgttttcttgcgataaacac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45667047 |
cctggattttcttcaggtttattactaagtattcctgtgaatggtatctccttttccatgtataatgatgatccacgccgtgttttcttgcgataaacac |
45666948 |
T |
|
| Q |
188 |
atgatctgacattgttacaccatccac |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45666947 |
atgatctgacattgttacaccatccac |
45666921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 88 - 150
Target Start/End: Complemental strand, 38257829 - 38257767
Alignment:
| Q |
88 |
cctggattttcttcaggtttattactaagtattcctgtgaatggtatctccttttccatgtat |
150 |
Q |
| |
|
||||| ||||||||||||||||| || | |||||||||||||||||| | |||||||||||| |
|
|
| T |
38257829 |
cctgggttttcttcaggtttattgctcaatattcctgtgaatggtatttgattttccatgtat |
38257767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University