View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_high_63 (Length: 218)
Name: NF10080_high_63
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_high_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 76 - 199
Target Start/End: Original strand, 19467953 - 19468078
Alignment:
| Q |
76 |
ttgtagaactcaaacaacgcttctttacgttgattgctgacatgtgtttcacacttatgccactcaaaatcagttactttttcaagagttaatctgg--a |
173 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
19467953 |
ttgtagaactcaaagaacgtttctttacgttgattactgacatgtgtttcacacttatgccactcaaaatcagttactttttcaagagttaatctggata |
19468052 |
T |
|
| Q |
174 |
tagttggatccttttttcgtatcctt |
199 |
Q |
| |
|
||||||| || ||||||||||||||| |
|
|
| T |
19468053 |
tagttgggtcgttttttcgtatcctt |
19468078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 25 - 77
Target Start/End: Original strand, 19467857 - 19467909
Alignment:
| Q |
25 |
ataagtgacacgcttgatgttttattattatttattgaatttctgttgaaatt |
77 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
19467857 |
ataagtgacacccttgatgtttgattattatttattgaatttctattgaaatt |
19467909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University