View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_34 (Length: 332)
Name: NF10080_low_34
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 32 - 324
Target Start/End: Complemental strand, 28728842 - 28728534
Alignment:
| Q |
32 |
aggaaagggttgtttgttggtgtagactgatgttatgattcagaggaagagttactacttttgtttggattttttgagtaaacttggctgctcttaaatt |
131 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
28728842 |
aggaaaggattgtttgttggtgtagactgatgttatgattcagaggaagtgttactacttttgtttgggttttgtgagtaaacttggctgctcttaaatt |
28728743 |
T |
 |
| Q |
132 |
gtcatctctagaaactcactcttgcaatctttctacctgtaggcacagccaatcagtattatgtgtcttacaacactcctcttgcttg------------ |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28728742 |
gtcatctctagaaactcactcttgcaatctttctacctgtaggcacagccaatcagtattatgtgtcttacaactctcctcttgcttgattttcctttgt |
28728643 |
T |
 |
| Q |
220 |
----atgatgaaatagggtgaacggatagaaatatttgcgaaatgagtttgtatgcacctaaaataatttagttctcattcattgattgactaaactgtt |
315 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28728642 |
acctatgatgaaatagtgcgaacggatagaaatatttgcgaaatgagtttttatgcacctaaaataatttagttctcattcattggttgactaaactgtt |
28728543 |
T |
 |
| Q |
316 |
gtctctgct |
324 |
Q |
| |
|
|||| |||| |
|
|
| T |
28728542 |
gtctttgct |
28728534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 273 - 319
Target Start/End: Complemental strand, 28735274 - 28735228
Alignment:
| Q |
273 |
cctaaaataatttagttctcattcattgattgactaaactgttgtct |
319 |
Q |
| |
|
||||||||||| |||||| |||||||||||| |||||| |||||||| |
|
|
| T |
28735274 |
cctaaaataatatagttcacattcattgattaactaaaatgttgtct |
28735228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University