View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_35 (Length: 330)
Name: NF10080_low_35
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10080_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 4 - 324
Target Start/End: Original strand, 55939509 - 55939830
Alignment:
Q |
4 |
gactttggtgttgatacttctcttcacctgtagcattgtttgatccagttttagttgtattacacttaattataaattatatggtgtctcgttttatgg- |
102 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55939509 |
gactctggtgttgatacttctcttcacctgtagcattgtttaatccagttttagttgtattacacttaattataaattatatggtgtctcgttttatggg |
55939608 |
T |
 |
Q |
103 |
tttattaggttattttctttgatattcggcctaaaatcaagttgtgtattgttcttagtttacattagtcttttacatctaataaatatgctaagtaata |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55939609 |
tttattaggttattttctttgatattcggcctaaaatcaagttgtgtattgttcttagtttacattagtcttttacatctaataaatatgctaagtaata |
55939708 |
T |
 |
Q |
203 |
tgtttttagttaaagggaatatgtatatgaaaccctgtctaattgtattactattggccgtcaacatactatctaacactctctttttcaacgctctatt |
302 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
55939709 |
tgtttttagttaaagggaatctgtatatgaaaccctgtctaattgtattactattggccgtaaacatactatctaacactctctttttcaacgctctatt |
55939808 |
T |
 |
Q |
303 |
tataattggatgaaattcttat |
324 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
55939809 |
tataattggatgaaattcttat |
55939830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University