View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_37 (Length: 323)
Name: NF10080_low_37
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10080_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 195 - 316
Target Start/End: Original strand, 6221391 - 6221512
Alignment:
Q |
195 |
tcaatttcggtatattcacttgccaaggtggcgtcaaaacaatgaatctttatactattataactgttctagcttaaaaaacaaaaggaacaaaatttta |
294 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6221391 |
tcaatttcggtatattcacttgccaaggtggcgtcaaaacaatgaatctttatactattataactgttctagcttaaaaaacaaaaggaacaaaatttta |
6221490 |
T |
 |
Q |
295 |
atttgaccgaacaaaacaccaa |
316 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
6221491 |
atttgaccgaacaaaacaccaa |
6221512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 16 - 134
Target Start/End: Original strand, 6221210 - 6221330
Alignment:
Q |
16 |
catagtacctcttgaagatctttatcggtttatccttctggttaagatcttaaagttttgggaaca--attcatgtattgtttctgaaatgctgccaaag |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
6221210 |
catagtacctcttgaagatctttatcggtttatccttctggttaagatcttaaagttttgggaacaatattcatgtattgtttctgaaatgctgccaaag |
6221309 |
T |
 |
Q |
114 |
ttcattcataattattgcttg |
134 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
6221310 |
ttcattcataattattgcttg |
6221330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University