View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_41 (Length: 304)
Name: NF10080_low_41
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 33806010 - 33806290
Alignment:
| Q |
1 |
gaagcaacaaagatcagcaaacaacaaatatgcaactagatcaaggattggtaaaacaaatccttcacaataaagagttttttctagaatgtaaggggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33806010 |
gaagcaacaaagatcagcaaacaacaaatatgcaactagatcaaggattggtaaaacaaatccttcacaataaagagttttttctggaatgtaaggggtt |
33806109 |
T |
 |
| Q |
101 |
tagctaacgcctccactagattagctcttaagaggtttcttgatgttaataaaccaaaatttgttttattagtgaaccatggttggagcatgattctctt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33806110 |
tagctaacgcccccactagattagctcttaagaggtttcttgatgttaataaaccaaattttgttttattagtgaaccatggttggagcatgattctctt |
33806209 |
T |
 |
| Q |
201 |
ccgagagtttggtttagtagacttggtggcaaacttttcggttctaatattagaaacaatttgaagcctaatctttggtgc |
281 |
Q |
| |
|
|| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33806210 |
cctagagtttggtttagtagacatggtgacaaacttttcggttctaatattagaaaaaatttgaagcctaatctttggtgc |
33806290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University