View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_50 (Length: 279)
Name: NF10080_low_50
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10080_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 51 - 146
Target Start/End: Complemental strand, 21832497 - 21832402
Alignment:
Q |
51 |
ggtaacggatggtgaaacaaatgttagggtttgtagttaggttatggttgtactgttgcgttactgaatgatccttggagttaggttatatttacg |
146 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21832497 |
ggtaacagatggtgaaacaaatgttagggtttgtagttaggttatggttgtactgttgcgttactgaatgatccttggagttaggttatatttacg |
21832402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 202 - 264
Target Start/End: Complemental strand, 21832347 - 21832285
Alignment:
Q |
202 |
acataaaattcaacttcattcaattaggaaatggattatcggcaacacttatttctccacact |
264 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
21832347 |
acataaaattcaacttcattcaattgggaaatggattatcggcaacacttatttctccacact |
21832285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University