View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_64 (Length: 242)
Name: NF10080_low_64
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 15288834 - 15288620
Alignment:
| Q |
12 |
tgagaagaagattaatggctccgttgaagatccaaccgattgacatagattcagagaaagccactacggaactggttcgaaatgaaccagtttcgaaatg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15288834 |
tgagaagaagattaatggctccgttgaagatccaaccgattgacatagattcagagaaagccactacggaactggttcgaaatgaaccagtttcgaagtg |
15288735 |
T |
 |
| Q |
112 |
gaggttgaagaggtttttcgctttcgagaaaccttttccgaagaacaataccactaaagatggtgctggtggagttgctgagttggaaccaagctctgtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288734 |
gaggttgaagaggtttttcgctttcgagaaaccttttccgaagaacaataccactaaagatggtgctggtggagttgctgagttggaaccaagctctgtt |
15288635 |
T |
 |
| Q |
212 |
tgcttggcgaaaatg |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15288634 |
tgcttggcgaaaatg |
15288620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University