View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_70 (Length: 238)
Name: NF10080_low_70
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10080_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 16411042 - 16410825
Alignment:
Q |
1 |
aaggtaggtaacactgtaatttctactatattttttgttgtgtatttatactctaatattctgctttataatcgttctttcagttttatttttagcataa |
100 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
T |
16411042 |
aaggaaggtaacactgtaatttctactatattttttattgtgtatttatactctaatattctgcttcataatcgttctttcagt------tttagcataa |
16410949 |
T |
 |
Q |
101 |
cttcaagtcagcttaataatcatctagtttttactcnnnnnnngttgcttcattttagtcattgtatgtagctattttaatctatgaagcacgaacacct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
16410948 |
cttcaagtcagcttaataatcatctagtttttactttttttttgttgcttcattttagtcattgtatgtagctattttaatctatgaagcacggacacct |
16410849 |
T |
 |
Q |
201 |
ctaggactaggcggcgtgtcgtgt |
224 |
Q |
|
|
|||||||||||| ||||||||||| |
|
|
T |
16410848 |
ctaggactaggcagcgtgtcgtgt |
16410825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 211
Target Start/End: Original strand, 25092123 - 25092155
Alignment:
Q |
179 |
aatctatgaagcacgaacacctctaggactagg |
211 |
Q |
|
|
||||||||||||||| ||||||||||||||||| |
|
|
T |
25092123 |
aatctatgaagcacggacacctctaggactagg |
25092155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University