View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10080_low_72 (Length: 237)

Name: NF10080_low_72
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10080_low_72
NF10080_low_72
[»] chr7 (1 HSPs)
chr7 (88-214)||(45666921-45667047)
[»] chr1 (1 HSPs)
chr1 (88-150)||(38257767-38257829)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 88 - 214
Target Start/End: Complemental strand, 45667047 - 45666921
Alignment:
88 cctggattttcttcaggtttattactaagtattcctgtgaatggtatctccttttccatgtataatgatgatccatgccgtgttttcttgcgataaacac 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
45667047 cctggattttcttcaggtttattactaagtattcctgtgaatggtatctccttttccatgtataatgatgatccacgccgtgttttcttgcgataaacac 45666948  T
188 atgatctgacattgttacaccatccac 214  Q
    |||||||||||||||||||||||||||    
45666947 atgatctgacattgttacaccatccac 45666921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 88 - 150
Target Start/End: Complemental strand, 38257829 - 38257767
Alignment:
88 cctggattttcttcaggtttattactaagtattcctgtgaatggtatctccttttccatgtat 150  Q
    ||||| ||||||||||||||||| || | |||||||||||||||||| |  ||||||||||||    
38257829 cctgggttttcttcaggtttattgctcaatattcctgtgaatggtatttgattttccatgtat 38257767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University