View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_73 (Length: 236)
Name: NF10080_low_73
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_low_73 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 49266454 - 49266659
Alignment:
| Q |
17 |
gagacactctccaattctgccttaggactcgaggaactcagcaattttgatctctctgcacaaatgataaagtattatgtagaga---gggcaatgtctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49266454 |
gagacactctccaattctgccttaggactcgaggaactcagcaattttgatctctctgcacaaatgataaagtattatgtagagatcagggcaatgtcaa |
49266553 |
T |
 |
| Q |
114 |
-aagctcataaggataaatgagcaaagccataggtaaattataatactttgaaagagcttgtttgtaaaacacgttaccaattatcttaaaataaaacaa |
212 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49266554 |
gaagctcataaggataaaggagcaaacccataggtaaattataatactttgaaagagcttgtttgtaaaacacgttaccaattatctaaaaataaaacaa |
49266653 |
T |
 |
| Q |
213 |
cccaac |
218 |
Q |
| |
|
|||||| |
|
|
| T |
49266654 |
cccaac |
49266659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University