View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10080_low_76 (Length: 231)
Name: NF10080_low_76
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10080_low_76 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 95 - 159
Target Start/End: Original strand, 36680082 - 36680146
Alignment:
| Q |
95 |
tgatgtcagtatgtagtagctctgaacacccggcattgagaacttcctttgcttgctctgtctgt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36680082 |
tgatgtcagtatgtagtagctctgaacacccggcgttgagaacttcctttgcttgctctgtctgt |
36680146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 52 - 97
Target Start/End: Original strand, 36686695 - 36686740
Alignment:
| Q |
52 |
aaatgaagaataacacgtgaccatttttaaacaacattccatgtga |
97 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36686695 |
aaatgaagaataacacgtgaccatttataaacaacattccatgtga |
36686740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University