View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10080_low_76 (Length: 231)

Name: NF10080_low_76
Description: NF10080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10080_low_76
NF10080_low_76
[»] chr4 (2 HSPs)
chr4 (95-159)||(36680082-36680146)
chr4 (52-97)||(36686695-36686740)


Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 95 - 159
Target Start/End: Original strand, 36680082 - 36680146
Alignment:
95 tgatgtcagtatgtagtagctctgaacacccggcattgagaacttcctttgcttgctctgtctgt 159  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
36680082 tgatgtcagtatgtagtagctctgaacacccggcgttgagaacttcctttgcttgctctgtctgt 36680146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 52 - 97
Target Start/End: Original strand, 36686695 - 36686740
Alignment:
52 aaatgaagaataacacgtgaccatttttaaacaacattccatgtga 97  Q
    |||||||||||||||||||||||||| |||||||||||||||||||    
36686695 aaatgaagaataacacgtgaccatttataaacaacattccatgtga 36686740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University