View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10081_high_4 (Length: 247)
Name: NF10081_high_4
Description: NF10081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10081_high_4 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 38750389 - 38750143
Alignment:
Q |
1 |
ttcatctggttccccttcatctcttcaggcttataaactccatactcaaactcacacagtacgcaaacggggtctgcttaagcctcaccgtgctgtcaat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38750389 |
ttcatctggttccccttcatctcttcaggcttataaactccatactcaaactcacacagtacgcaaacggggtctgcttaagcctcaccgtgctgtcaat |
38750290 |
T |
 |
Q |
101 |
cagcagagccaaactagcattagaacttcatggcctcgggtgtcactttcacttttcggcgcaggattcgtgttgggtccacttcttgatggactccatt |
200 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38750289 |
cagcagagccaaactagcgttagaacttcatggcctcgggtgtcactttcacttttcggcgcaggattcgtgttgggtccacttcttgatggactccatt |
38750190 |
T |
 |
Q |
201 |
cgagagtcgaactcgtggcatacaagtctggggctattgacatcggt |
247 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38750189 |
cgagagtcgaactcgtggcatacaagtctggggctattgacatcggt |
38750143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University