View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10081_high_5 (Length: 240)
Name: NF10081_high_5
Description: NF10081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10081_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 24908451 - 24908234
Alignment:
| Q |
16 |
aaaagtagtagcaaagctgcatttggagacaatattttggttctggtcgaatgggtatgtttctgagtccttttatatgaataatgttgaccatggaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24908451 |
aaaagtagtagcaaagctgcatttggagacaatattttggttctggtcgaatgggtatgtttctgagtccttttatatgaataatgttgaccatggaagt |
24908352 |
T |
 |
| Q |
116 |
taaaaacggttaatcatgctttacaacacaactgaaattaaggtttcacactctaaggagtttcctcacaagacgcccagtagaggaatttgaatgagtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
24908351 |
taaaaacggttaatcatgctttacaacacaactgaaattaaggtttcacactctaaggagtttcctcagaagacgcccagtagaggaatttcaatgagtt |
24908252 |
T |
 |
| Q |
216 |
gagcagaaaacacctatg |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24908251 |
gagcagaaaacacctatg |
24908234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University