View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10081_low_12 (Length: 234)
Name: NF10081_low_12
Description: NF10081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10081_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 47877499 - 47877706
Alignment:
| Q |
17 |
caatcacagctctctgaggaaaatactatacttggcagtgataataatcaatcaaattaagtacttacgcgttctttccattggacgcaccaaacaagtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47877499 |
caatcacagctctctgaggaaaatactatacttggcagtgataataatcaatcaaattaagtacttacgcgttctttccattgaacgcaccaaacaagtt |
47877598 |
T |
 |
| Q |
117 |
gatgcttttaaatgattatatgcttggtgacaataagaattaggtaaagttttacacgtttgcacacaagcacgcttacgtaaatagtgatgacaatgga |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47877599 |
gatgcttttaaaggattatatgcttggtgacaataagaattaggtaaagttttacacgtttgcacacaagcacgcttacgtaaatagtgatgacaatgga |
47877698 |
T |
 |
| Q |
217 |
tgcctatg |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
47877699 |
tgcctatg |
47877706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University