View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10081_low_5 (Length: 416)
Name: NF10081_low_5
Description: NF10081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10081_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 6e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 212 - 324
Target Start/End: Complemental strand, 42591004 - 42590891
Alignment:
| Q |
212 |
caccagcttgtattacagttagaaattatctttaaccacactattccatagg-gaatgcccttcttcaattctgttatcaccactatgctcactacccaa |
310 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42591004 |
caccagcttgtattacggttagaaattatcttcaaccacactattccataggagaaggcccttcttcaattctgttatcaccactatgctcactacccaa |
42590905 |
T |
|
| Q |
311 |
tatgattgccatta |
324 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
42590904 |
catgactgccatta |
42590891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 66 - 175
Target Start/End: Complemental strand, 42591288 - 42591181
Alignment:
| Q |
66 |
atagaaaaagtttcattgcaacgcaaatagtaagccaccgtttcaattcatgctacgacatttcaacataatgtctatagaatggtgttaaaacgatgta |
165 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||| | |||| ||||||||||| | ||||||||| | ||| ||| ||||||||||||||||| || |
|
|
| T |
42591288 |
atagaaaaagtttcatttcaacacaaatagtaagctattgtttgaattcatgctaggtcatttcaac--actgtgtatgtaatggtgttaaaacgatata |
42591191 |
T |
|
| Q |
166 |
cacgaaacat |
175 |
Q |
| |
|
|| ||||||| |
|
|
| T |
42591190 |
caagaaacat |
42591181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University