View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10081_low_7 (Length: 325)
Name: NF10081_low_7
Description: NF10081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10081_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 64 - 235
Target Start/End: Original strand, 6182272 - 6182443
Alignment:
| Q |
64 |
atcttgaaatctgaatatgactttcattttaggacaccactcgtcacatttctgacctttgaagatgggaagatttgtagggaaaatgtccgttgtttgt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
6182272 |
atcttgaaatctgaatatgactttcattttaggacaccacttgtcacatttctgacctttgaagatgggaagatttgcaggaaaaatgtccattgtttgt |
6182371 |
T |
|
| Q |
164 |
ggaattcgccattgttgaaaattaaaattgttgtatccaagatcgaatcaattgttacaccagtttgttgga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6182372 |
ggaattcgccattgttgaaaattaaaattgttgtatccaagatcgaatcaattgttacaccagtttgttgga |
6182443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 64 - 235
Target Start/End: Original strand, 6222447 - 6222618
Alignment:
| Q |
64 |
atcttgaaatctgaatatgactttcattttaggacaccactcgtcacatttctgacctttgaagatgggaagatttgtagggaaaatgtccgttgtttgt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
6222447 |
atcttgaaatctgaatatgactttcattttaggacaccacttgtcacatttctgacctttgaagatgggaagatttgcaggaaaaatgtccattgtttgt |
6222546 |
T |
|
| Q |
164 |
ggaattcgccattgttgaaaattaaaattgttgtatccaagatcgaatcaattgttacaccagtttgttgga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6222547 |
ggaattcgccattgttgaaaattaaaattgttgtatccaagatcgaatcaattgttacaccagtttgttgga |
6222618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University