View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10082_low_3 (Length: 280)
Name: NF10082_low_3
Description: NF10082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10082_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 273
Target Start/End: Complemental strand, 50532126 - 50531872
Alignment:
| Q |
19 |
agattctttgtcgatacaaacccaggcttgtaaagtttatataacgttaaaggtgaaacaaactatgtgctgcttttaggctgtaagggtttggcaccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50532126 |
agattctttgtcgatacaaacccaggcttgtaaactttatataacgttaaaggtgaaacaaactatgtgctgcttttaggttgtaagggtttggcaccat |
50532027 |
T |
 |
| Q |
119 |
tgacagttggtttgcttgaatcaatctctgccatggtttccggtcggttacggtttcaactttgaattttcacatgaagccaaccattgaaattaaacac |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50532026 |
tgacagttggcttgcttgaatcaatctctgccatggtttccggtcggttacggtttcaactttgaattttcacatgaagccaaccattgaaattaaacac |
50531927 |
T |
 |
| Q |
219 |
ctgggttttattcatacccttcattcaatatcctcttctcttctctgctcctcct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50531926 |
ctgggttttattcatacccttcattcaatatcctcttctcttctcttctcctcct |
50531872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 21 - 233
Target Start/End: Complemental strand, 50533834 - 50533612
Alignment:
| Q |
21 |
attctttgtcgatacaaacccaggcttgtaaagtttatataacgt-----taaaggtgaaacaaactatgtgctg-----------cttttaggctgtaa |
104 |
Q |
| |
|
|||||||||| |||||||||||| ||||| || ||| |||||||| ||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
50533834 |
attctttgtcaatacaaacccagacttgttaactttttataacgtaacgttaaaggtgaaacaaactatgtgctgatatacataaacttttaggttgtat |
50533735 |
T |
 |
| Q |
105 |
gggtttggcaccattgacagttggtttgcttgaatcaatctctgccatggtttccggtcggttacggtttcaactttgaattttcacatgaagccaacca |
204 |
Q |
| |
|
|||||| |||| || |||||||| ||||||||||| |||||||||||| ||||||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
50533734 |
aggtttgtcacctttcacagttggcttgcttgaatc----tctgccatggtt-ccggtcggttagggtttcacctt-gaattttcacatgaagccaacca |
50533641 |
T |
 |
| Q |
205 |
ttgaaattaaacacctgggttttattcat |
233 |
Q |
| |
|
||||||||||| ||| |||||||||||| |
|
|
| T |
50533640 |
ttgaaattaaataccccggttttattcat |
50533612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University