View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10083_high_2 (Length: 225)
Name: NF10083_high_2
Description: NF10083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10083_high_2 |
 | |
|
| [»] scaffold0004 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0004 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 164
Target Start/End: Complemental strand, 123093 - 122948
Alignment:
| Q |
19 |
gtatgggagagaggtaagaagaaatggtgtggaacccaccgatgaccttgctgttgccattccctacaactcacccacatgctattactttgcttggtgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123093 |
gtatgggagagaggtaagaagaaatggtgtggaacccaccaatgaccttgctgttgccattccctacaactcacccacatgctattactttgcttggtgt |
122994 |
T |
|
| Q |
119 |
atatttaaattcaattcaacgcatcacattcacagtacatgtacat |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
122993 |
atatttaaattcaattcaacgcatcacatttacagtacatgtacat |
122948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 122916 - 122872
Alignment:
| Q |
171 |
acttgggatgggattaggccagtcattcattactcaacaccaaac |
215 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
122916 |
acttgggatgggattaggccagttattcattactcaacaacaaac |
122872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University