View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10083_low_2 (Length: 319)
Name: NF10083_low_2
Description: NF10083
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10083_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 43709392 - 43709076
Alignment:
Q |
1 |
tagcgttggacatggagaggcttaatatcaaattggctactcttgaggtagctcttaacatagcaagagacttgttgatggaagaaggcttcaatgggat |
100 |
Q |
|
|
|||||||||| |||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43709392 |
tagcgttggaaatggagaggcttaagacaaaattggctactcttgaggtagatcttaacatagcaagagacttgttgatggaagaaggcttcaatgggat |
43709293 |
T |
 |
Q |
101 |
agatttgaatgttgaactaggatatgggataccatagacctctttctctacattaacatgcatgtttatatggatggatttttaatgtcttgaataaatt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43709292 |
agatttgaatgttgaactaggatatgggataccatagacctctttctctacattaatatgcatgtttatatggatggatttttaatgtcttgaataaatt |
43709193 |
T |
 |
Q |
201 |
gtgactgcttgtctatctctctaataatacaatgttattgcagattcatctgttgacaaccgtaagtctttttattatatatattcaactattgttcatt |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
T |
43709192 |
gtgactgcttgtctatctctctaataatacaatgttattgcagattcatctgttgacaactg-aagtctttttattatatatattcaactattgttcatt |
43709094 |
T |
 |
Q |
301 |
gttcaatgcgtattgttg |
318 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
43709093 |
gttcaatgcgtattgttg |
43709076 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University