View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10084_high_5 (Length: 242)
Name: NF10084_high_5
Description: NF10084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10084_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 34257727 - 34257891
Alignment:
| Q |
18 |
attgcctacgcatccaacggttatcccggttttttgtgactataaatttagcttagctgctttgtgtttatggttttgaaagagcaacaagcataggtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257727 |
attgcctacgcatccaacggttatcccgtttttttgtgactcaaaagttagcttagctgctttgtgtttatggttttgaaagagcaacaagcataggtct |
34257826 |
T |
|
| Q |
118 |
agtgaattatgtatataaacaatgtatataagtgactcaaacttagctaagctgctttttgtcta |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34257827 |
agtgaattatgtatataaacaatgtatataagtgactcaaacttagctaagctgctttttgtcta |
34257891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 160 - 230
Target Start/End: Original strand, 34257774 - 34257844
Alignment:
| Q |
160 |
ttagctaagctgctttttgtctatggttttgaaatagcaacaagcattgctcaagtgaattatgtatataa |
230 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||||||| |||||||||||| | || |||||||||||||||||| |
|
|
| T |
34257774 |
ttagcttagctgctttgtgtttatggttttgaaagagcaacaagcataggtctagtgaattatgtatataa |
34257844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University