View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10084_low_10 (Length: 310)
Name: NF10084_low_10
Description: NF10084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10084_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 107 - 218
Target Start/End: Complemental strand, 40250547 - 40250436
Alignment:
| Q |
107 |
tggctggtgagtttgattttgtagtgaagaataatgaaataaaaatggagtagtaggtgggtttgtgtgtttcttcaaaatcgataaaaggaagaacaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40250547 |
tggctggtgagtttgattttgtagtgaagaataatgaaataaaaatggagtagtaggtgggtttgtgtgtttcttcaaaatcaataaaaggaagaacaat |
40250448 |
T |
 |
| Q |
207 |
ggtggataaaaa |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40250447 |
ggtggataaaaa |
40250436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 212 - 276
Target Start/End: Original strand, 40249727 - 40249791
Alignment:
| Q |
212 |
ataaaaagaattccctcattcacattttgacatttgacgtgaagaaagaatatgattataatagg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40249727 |
ataaaaagaattccctcattcacattttgacatttgacgtgaagaaagaatatgattataatagg |
40249791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University