View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10084_low_12 (Length: 255)
Name: NF10084_low_12
Description: NF10084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10084_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 22 - 181
Target Start/End: Complemental strand, 34258238 - 34258079
Alignment:
Q |
22 |
tggttattttaccaaaaatattcagatacttcataataaaactaaaatgcataagtattgtatttaatgaatttttaaaacattaatgtagaaaatgcca |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
34258238 |
tggttattttaccaaaaatattcagatacttcataataaaactaaaatgcataagtattgtatttaatgaattttgaaaacattaatgtagaaaatgcca |
34258139 |
T |
 |
Q |
122 |
atcctgaaaggtttgaagtagcactagcaccaaatagacctatcagtttccattttccaa |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34258138 |
atcctgaaaggtttgaagtagcactagcaccaaatagacctatcagtttccattttccaa |
34258079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 188 - 255
Target Start/End: Complemental strand, 34257983 - 34257916
Alignment:
Q |
188 |
aaaattagatttctgaatagaagaaaattcacaaccatgccaacaaaattttgtattacataatttat |
255 |
Q |
|
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34257983 |
aaaataagatttctcaatagaagaaaattcacaaccatgccaacaaaattttgtattacataatttat |
34257916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University