View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10084_low_17 (Length: 235)
Name: NF10084_low_17
Description: NF10084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10084_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 13867849 - 13867633
Alignment:
| Q |
1 |
tgcaatgtgtttatgtccggatcaatggtgaagcctatgatgaaggtaaacttgggatagacatcgctacggagttggagcgccttttcgatccaggttt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13867849 |
tgcaacgtgtttatgtccggatcaatggcgaagcctaagatgaaggtaaacttgggatagacatcgctacggagttggagcgccttttcgatccaggttt |
13867750 |
T |
|
| Q |
101 |
ggacgacggaggcaacggaagtaactgtgacgatgatattggtgccccacaggttgacgatgtaaatgatatgatccacgttgggctgacggtcgacgac |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13867749 |
ggacga-ggaggcaacggaagtaactgtgacgatgatattggtgccccacaggttgacgatgtaaatgatatgatccacgttgggctgacggtcgacgac |
13867651 |
T |
|
| Q |
201 |
ggtgcccaccattttatt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13867650 |
ggtgcccaccattttatt |
13867633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 216
Target Start/End: Original strand, 11876557 - 11876657
Alignment:
| Q |
116 |
cggaagtaactgtgacgatgatattggtgccccacaggttgacgatgtaaatgatatgatccacgttgggctgacggtcgacgacggtgcccaccatttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||| || ||||||||| |||| || || | | |||||||||| || |||||||||||||| |
|
|
| T |
11876557 |
cggaagtaactgtgacgatgatattggtatcgtacaggtttacaatgtaaatgttatggtcgacctgaagttgacggtcgaggatagtgcccaccatttt |
11876656 |
T |
|
| Q |
216 |
a |
216 |
Q |
| |
|
| |
|
|
| T |
11876657 |
a |
11876657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University