View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10084_low_18 (Length: 231)
Name: NF10084_low_18
Description: NF10084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10084_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 37550988 - 37550797
Alignment:
Q |
19 |
tataacgattgaagtagaacatctcatccacgtggctccacgtcacaacctttgaagattaaagtttcaacttgagaaaggaactaaaaaatggccacac |
118 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
37550988 |
tataacgatagaagtagaacatctcatccacgtggctccacgtcacaacctttgaagattaaagtt-caacttgagaaaggaactaaaaaatggccacac |
37550890 |
T |
 |
Q |
119 |
aaacaaaaacacgaaattgcactctccgccgtataatatccattcaaacattgcatttccataatctcatagatagataagatttttgacaacattg |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
37550889 |
aaacaaaaacacgaaattgcactctccgccgtataatatccattcaaacatagcatttccataatctcata----gataagatttttgacaacattg |
37550797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University