View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10085_high_10 (Length: 280)
Name: NF10085_high_10
Description: NF10085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10085_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 5799508 - 5799248
Alignment:
| Q |
1 |
gatttgtaaaggaagggtgtttgccctagacaacgattcagcagttcctcgactttggcttcccaatgctgattcacctggcctagctatgtcacgagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799508 |
gatttgtaaaggaagggtgtttgccctagacaacgattcagcagttcctcgactttggcttcccaatgctgattcacctggcctagctatgtcacgagct |
5799409 |
T |
 |
| Q |
101 |
tttggcgactttgtcctcaaggactcaggactcatatctgttcctgaagtctcctatcaccgcatcaccgaccatgatcagtttgttgttttagccacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799408 |
tttggcgactttgtcctcaaggactcaggactcatatctgttcctgaagtctcctatcaccgcatcaccgaccatgatcagtttgttgttttagccacag |
5799309 |
T |
 |
| Q |
201 |
atggggtttgggatgttttatccaacaatcaagttgtgaacattgtggcatctgctccacg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799308 |
atggggtttgggatgttttatccaacaatcaagttgtgaacattgtggcatctgctccacg |
5799248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University