View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10085_high_17 (Length: 203)
Name: NF10085_high_17
Description: NF10085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10085_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 11172872 - 11173043
Alignment:
Q |
19 |
tcttctctgtttttcttagtgatactgttgtacagaaaacaagaaaactgttgagctctcaacactgtttcttggatctgaagaagttagtggaaacata |
118 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
11172872 |
tcttctctgtttttcttagtgatactgttgtacagaaaacaagaaaactgttgagctctcagcactgtttcttggatctgaagaagttagtggaaacata |
11172971 |
T |
 |
Q |
119 |
taacaatcatgaacaatctcacaaaccaatttattagtatagtttaatttcaatttcacacggtcctatgct |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11172972 |
taacaatcatgaacaatctcacaaaccaatttattagtatagtttaatttcaatttcacacggtcctatgct |
11173043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University