View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10085_high_4 (Length: 318)
Name: NF10085_high_4
Description: NF10085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10085_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 34787460 - 34787315
Alignment:
| Q |
17 |
tagggttgggtctgcaactttggaagaagacatggctagggcttggaaaaccctaacgatagagaaagaggaagaatgtgtttttgtttctgttgagtgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34787460 |
tagggttgggtctgcaactttggaagaagacatggctagggcttggaaaaccctaacgatagagaaagaggaagaatgtgtttttgtttctgttgagtgt |
34787361 |
T |
|
| Q |
117 |
gtaaatctttcttatttaaataggtttcttcacgggcttttcggct |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34787360 |
gtaaatctttcttatttaaataggtttcttcacgggcttttcggct |
34787315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 228 - 300
Target Start/End: Complemental strand, 34787249 - 34787177
Alignment:
| Q |
228 |
caattcccttttgtttaaaactttaatcttacatatctttcctacggaagttatatcctacacccctatattt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
34787249 |
caattcccttttgtttaaaactttaatcttacatatctttcttacggaagttatatcctacacccctacattt |
34787177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 2293737 - 2293777
Alignment:
| Q |
17 |
tagggttgggtctgcaactttggaagaagacatggctaggg |
57 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2293737 |
tagggttgggtctgcatctttggaagaagacatggctaggg |
2293777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University