View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10085_high_4 (Length: 318)

Name: NF10085_high_4
Description: NF10085
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10085_high_4
NF10085_high_4
[»] chr6 (2 HSPs)
chr6 (17-162)||(34787315-34787460)
chr6 (228-300)||(34787177-34787249)
[»] chr5 (1 HSPs)
chr5 (17-57)||(2293737-2293777)


Alignment Details
Target: chr6 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 34787460 - 34787315
Alignment:
17 tagggttgggtctgcaactttggaagaagacatggctagggcttggaaaaccctaacgatagagaaagaggaagaatgtgtttttgtttctgttgagtgt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34787460 tagggttgggtctgcaactttggaagaagacatggctagggcttggaaaaccctaacgatagagaaagaggaagaatgtgtttttgtttctgttgagtgt 34787361  T
117 gtaaatctttcttatttaaataggtttcttcacgggcttttcggct 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
34787360 gtaaatctttcttatttaaataggtttcttcacgggcttttcggct 34787315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 228 - 300
Target Start/End: Complemental strand, 34787249 - 34787177
Alignment:
228 caattcccttttgtttaaaactttaatcttacatatctttcctacggaagttatatcctacacccctatattt 300  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||    
34787249 caattcccttttgtttaaaactttaatcttacatatctttcttacggaagttatatcctacacccctacattt 34787177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 2293737 - 2293777
Alignment:
17 tagggttgggtctgcaactttggaagaagacatggctaggg 57  Q
    |||||||||||||||| ||||||||||||||||||||||||    
2293737 tagggttgggtctgcatctttggaagaagacatggctaggg 2293777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University